Sequence¶
The Sequence object contains classes that represent biological sequence data. These provide generic biological sequence manipulation functions, plus functions that are critical for the evolve module calculations.
Warning
Do not import sequence classes directly! It is expected that you will access them through MolType objects. The molecular types can be accessed via the cogent3.get_moltype() function. Sequence classes depend on information from the MolType that is only available after MolType has been imported. Sequences are intended to be immutable. This is not enforced by the code for performance reasons, but don’t alter the MolType or the sequence data after creation.
DNA and RNA sequences¶
Creating a DNA sequence from a string¶
All sequence and alignment objects have a molecular type, or MolType which provides key properties for validating sequence characters. Here we use the DNA MolType to create a DNA sequence.
>>> from cogent3 import DNA
>>> my_seq = DNA.make_seq("AGTACACTGGT")
>>> my_seq
DnaSequence(AGTACAC... 11)
>>> print(my_seq)
AGTACACTGGT
>>> str(my_seq)
'AGTACACTGGT'
Creating a RNA sequence from a string¶
>>> from cogent3 import RNA
>>> rnaseq = RNA.make_seq('ACGUACGUACGUACGU')
Converting to FASTA format¶
>>> from cogent3 import DNA
>>> my_seq = DNA.make_seq('AGTACACTGGT')
>>> print(my_seq.to_fasta())
>0
AGTACACTGGT
Convert a RNA sequence to FASTA format¶
>>> from cogent3 import RNA
>>> rnaseq = RNA.make_seq('ACGUACGUACGUACGU')
>>> rnaseq.to_fasta()
'>0\nACGUACGUACGUACGU\n'
Creating a named sequence¶
You can also use a convenience make_seq() function, providing the moltype as a string.
>>> from cogent3 import make_seq
>>> my_seq = make_seq('AGTACACTGGT','my_gene', moltype="dna")
>>> my_seq
DnaSequence(AGTACAC... 11)
>>> type(my_seq)
<class 'cogent3.core.sequence.DnaSequence'>
Setting or changing the name of a sequence¶
>>> from cogent3 import make_seq
>>> my_seq = make_seq('AGTACACTGGT', moltype="dna")
>>> my_seq.name = 'my_gene'
>>> print(my_seq.to_fasta())
>my_gene
AGTACACTGGT
Complementing a DNA sequence¶
>>> from cogent3 import DNA
>>> my_seq = DNA.make_seq("AGTACACTGGT")
>>> print(my_seq.complement())
TCATGTGACCA
Reverse complementing a DNA sequence¶
>>> print(my_seq.rc())
ACCAGTGTACT
The rc method name is easier to type
>>> print(my_seq.rc())
ACCAGTGTACT
Translate a DnaSequence to protein¶
>>> from cogent3 import DNA
>>> my_seq = DNA.make_seq('GCTTGGGAAAGTCAAATGGAA','protein-X')
>>> pep = my_seq.get_translation()
>>> type(pep)
<class 'cogent3.core.sequence.ProteinSequence'>
>>> print(pep.to_fasta())
>protein-X
AWESQME
Converting a DNA sequence to RNA¶
>>> from cogent3 import DNA
>>> my_seq = DNA.make_seq('ACGTACGTACGTACGT')
>>> print(my_seq.to_rna())
ACGUACGUACGUACGU
Convert an RNA sequence to DNA¶
>>> from cogent3 import RNA
>>> rnaseq = RNA.make_seq('ACGUACGUACGUACGU')
>>> print(rnaseq.to_dna())
ACGTACGTACGTACGT
Testing complementarity¶
>>> from cogent3 import DNA
>>> a = DNA.make_seq("AGTACACTGGT")
>>> a.can_pair(a.complement())
False
>>> a.can_pair(a.rc())
True
Joining two DNA sequences¶
>>> from cogent3 import DNA
>>> my_seq = DNA.make_seq("AGTACACTGGT")
>>> extra_seq = DNA.make_seq("CTGAC")
>>> long_seq = my_seq + extra_seq
>>> long_seq
DnaSequence(AGTACAC... 16)
>>> str(long_seq)
'AGTACACTGGTCTGAC'
Slicing DNA sequences¶
>>> my_seq[1:6]
DnaSequence(GTACA)
Getting 3rd positions from codons¶
The easiest approach is to work off the cogent3 ArrayAlignment object.
We’ll do this by specifying the position indices of interest, creating a sequence Feature and using that to extract the positions.
>>> from cogent3 import DNA
>>> seq = DNA.make_array_seq('ATGATGATGATG')
>>> pos3 = seq[2::3]
>>> assert str(pos3) == 'GGGG'
Getting 1st and 2nd positions from codons¶
In this instance we can use the annotatable sequence classes.
>>> from cogent3 import DNA
>>> seq = DNA.make_seq('ATGATGATGATG')
>>> indices = [(i, i+2) for i in range(len(seq))[::3]]
>>> pos12 = seq.add_feature('pos12', 'pos12', indices)
>>> pos12 = pos12.get_slice()
>>> assert str(pos12) == 'ATATATAT'
Return a randomized version of the sequence¶
print rnaseq.shuffle()
ACAACUGGCUCUGAUG
Remove gaps from a sequence¶
>>> from cogent3 import RNA
>>> s = RNA.make_seq('--AUUAUGCUAU-UAu--')
>>> print(s.degap())
AUUAUGCUAUUAU